Macropinocytosis promotes lung adenocarcinoma cell malignancy by upregulating KCNH1 expression
Highlight box
Key findings
• Macropinocytosis enhances malignant phenotypes in lung adenocarcinoma (LUAD) cells by transcriptionally upregulating KCNH1. Pharmacological or genetic inhibition of this axis suppresses tumor cell proliferation, migration, and invasion.
What is known and what is new?
• Macropinocytosis is a known metabolic adaptation in RAS-driven cancers, and the oncogenic ion channel KCNH1 has been implicated in cell cycle progression in other malignancies. However, their functional connection in LUAD was previously undefined.
• This study establishes KCNH1 as a key downstream effector of macropinocytosis in LUAD, revealing a unidirectional regulatory axis. It provides the first evidence linking this nutrient-scavenging pathway to ion channel dysregulation in LUAD pathogenesis.
What is the implication, and what should change now?
• The macropinocytosis-KCNH1 axis represents a novel therapeutic target. Future work should focus on elucidating the precise transcriptional mechanism and evaluating the efficacy of targeting KCNH1, alone or in combination, in preclinical LUAD models.
Introduction
Background
Lung cancer continues to be the primary contributor to cancer-related deaths globally (1-3). Non-small cell lung cancer (NSCLC) accounts for around 85% of these instances, with lung adenocarcinoma (LUAD) being the predominant histological subtype (3-5). The clinical management of LUAD faces a significant challenge due to its frequent diagnosis at advanced stages and the inevitable development of therapeutic resistance (5,6). Despite landmark advances in targeted therapies against driver mutations [e.g., ALK receptor tyrosine kinase (ALK)] and the successful integration of immune checkpoint inhibitors (7-9), a substantial proportion of patients still experience disease progression (2). This underscores the urgent need to elucidate novel molecular mechanisms underlying LUAD pathogenesis and to identify actionable therapeutic vulnerabilities.
The survival and rapid proliferation of cancer cells demand a substantial and continuous supply of nutrients, a requirement often unmet by the compromised vasculature within solid tumors (10-12). To circumvent this metabolic constraint, malignant cells activate alternative nutrient-scavenging pathways (13,14). Among these, macropinocytosis—a conserved, receptor-independent form of bulk liquid-phase endocytosis—has emerged as a critical adaptive mechanism in various cancers (14,15). This process is characterized by the actin-driven formation of large vesicles, termed macropinosomes, which internalize extracellular fluid and proteins (16). This enables cancer cells to exploit the protein-rich tumor microenvironment as a source of amino acids and lipids, thereby fueling anabolic growth and maintaining redox homeostasis (16-18).
Rationale and knowledge gap
Although macropinocytosis is recognized as a critical metabolic support pathway in the Kirsten rat sarcoma viral oncogene homolog (KRAS)-driven cancers (19,20), its broader functional impact and specific molecular effectors in regulating LUAD cell malignant phenotypes remain underexplored. Importantly, beyond nutrient supply, emerging evidence suggests that macropinocytosis may actively drive oncogenic phenotypes through the dysregulation of downstream signaling effectors (15,21). Therefore, identifying these effectors may reveal actionable therapeutic targets for LUAD. To this end, we performed an unbiased transcriptomic screen and identified potassium voltage-gated channel subfamily H member 1 (KCNH1) as one of the most significantly downregulated genes upon macropinocytosis inhibition. KCNH1 encodes the ether-à-go-go 1 (Eag1) channel and regulates proliferation and migration in other cancer cells (e.g., HeLa cells), but its role in macropinocytosis and macropinocytosis-mediated enhancement of LUAD cell malignant behaviors has never been investigated (22-25).
Objective
Therefore, this study aims to determine whether macropinocytosis enhances LUAD cell malignant phenotypes through the specific upregulation of downstream effector molecules, with a focus on KCNH1. We hypothesize that a macropinocytosis-KCNH1 axis is critical for sustaining LUAD malignancy. By validating KCNH1 as a key functional target, our work seeks to establish a novel conceptual link between nutrient scavenging and ion channel signaling in LUAD, revealing a potential new target for therapeutic intervention. We present this article in accordance with the MDAR reporting checklist (available at https://jlpm.amegroups.com/article/view/10.21037/jlpm-2026-0020/rc).
Methods
Cell culture
Shanghai Fuheng Biotechnology Co., Ltd. (Shanghai, China) provided the human LUAD cell lines NCI-H358 (FH0046, H358) and NCI-H1975 (FH0086, H1975). The HEK293T cell line was generously gifted from Shanghai Chest Hospital central laboratory. HEK293T was cultured in Dulbecco’s modified Eagle’s medium (DMEM, L100-500, BDBio, Hangzhou, China) supplemented with 10% fetal bovine serum (FBS, F801-500, BDBio) and 1% penicillin/streptomycin (PS, AC03L332, Life-iLab, Shanghai, China), while H358 and H1975 were cultured with RPMI-1640 medium with 10% FBS and 1% PS. Cells were incubated in a humidified environment with 5% CO2 at 37 ℃. All cell lines were authenticated using short tandem repeat profiling. None of the cell lines used in this study are listed in the International Cell Line Authentication Committee (ICLAC) database of commonly misidentified cell lines.
For the reagents used for cell treatments, dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich (St. Louis, MO, USA). 5-(N-ethyl-N-isopropyl)-amiloride (EIPA) was purchased from MedChemExpress (HY-101840, Monmouth Junction, NJ, USA). The concentration (25 µM) and treatment duration (24 hours) of EIPA were selected based on previous studies (16). Throughout all experiments involving EIPA in this study, the dosage of EIPA was kept consistent. Detailed experimental groupings are provided in the figure legends.
Western blot (WB)
Cell lysis buffer was used to extract proteins (Beyotime, P0013, Shanghai, China). The lysates were centrifuged at 12,000 rpm for 20 minutes at 4 ℃ after being incubated on ice for 30 minutes. Protein concentration was measured using a BCA assay kit (P0009, Beyotime) after supernatants were gathered. After mixing the samples with 5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (P0015, Beyotime), they were denatured for 15 minutes at 100 ℃. On 10% SDS-polyacrylamide gels, equal amounts of protein (15 µg per lane) were resolved. They were then transferred onto 0.22 µm polyvinylidene difluoride (PVDF) membranes (E802, Vazyme, Nanjing, China) at 400 mA for 70 minutes at 4 ℃. Membranes were blocked using 2% non-fat milk (P0216, Beyotime) made in PBST [PBS powder (G0002-15, Servicebio, Wuhan, China) plus Tween 20 (T8220, Solarbio, Beijing, China)] for 1 hour at room temperature. Primary antibodies were diluted in universal antibody diluent and incubated for the entire night at 4 ℃ with mild stirring. Membranes were probed with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at room temperature following three rounds of PBST washing. Specific bands were visualized using an enhanced chemiluminescence reagent (NCM Biotech, P10200, Suzhou, China). The software ImageJ was used for densitometry of the immune blots. Protein levels were normalized to GAPDH.
Primary antibodies: Anti-GAPDH (Servicebio, GB15002, 1:2,000); Anti-KCNH1 (Proteintech, 26426-1-AP, 1:5,000, Wuhan, China); Anti-phospho-AKT1/2/3 (ABclonal, AP1430, 1:5,000, Wuhan, China); Anti-AKT1/2 (ABclonal, A2696 ,1:1,000); HRP-linked anti-mouse IgG (CST, 7076, 1:2,000, Danvers, MA, USA) and HRP-linked anti-rabbit IgG (CST, 7074, 1:2,000) are examples of secondary antibodies.
Visualization and quantification of macropinosomes
Glass coverslips were used to plate the cells. Approximately 24 hours after seeding, or 50% confluency, cells were subjected to 18 hours of serum deprivation. To visualize macropinosomes, a macropinocytosis assay was conducted by incubating cells with 1 mg/mL tetramethylrhodamine (TMR)-dextran (Invitrogen, D1818, Carlsbad, CA, USA) in medium without serum for 30 min at 37 ℃. Cells were then washed three times with ice-cold PBS (Biotend, RE100001, Shanghai, China), fixed with 4% formaldehyde (Servicebio, G1101), DAPI (Servicebio, G1012) was used for nuclear staining. A laser scanning confocal microscope (BZ-X800, Keyence, Osaka, Japan) with a 60× oil immersion objective was used to take the pictures. Quantitative analysis of fluorescence intensity was conducted using ImageJ software.
Cell apoptosis
Cell apoptosis was evaluated using an Annexin V-FITC/PI apoptosis detection kit (Lianke Bio, AP101, Hangzhou, China). Briefly, cells were detached using trypsin without Ethylenediaminetetraacetic acid (EDTA), collected, and stained based on the manufacturer’s guidelines. Flow cytometric analysis (BD Biosciences, FACSCantoII, San Jose, CA, USA) was performed 5 min after staining to identify apoptotic cell populations.
Cell Proliferation
In 96-well plates, 2,000 cells were planted per well with 100 µL of media for the purpose of analyzing proliferation. Ten microliters of Cell Counting Kit-8 (CCK-8) solution (Selleck, B34304, Houston, TX, USA) were applied to each well between days one and five. Blanks were control wells with an equal volume of medium and cell-free CCK-8 solution. A microplate reader (Biotek, EPOCH2, Winooski, VT, USA) was used to measure the absorbance at 450 nm after an incubation of 1 hour.
Cell migration and invasion
An assay for wound healing was used to assess cell migration. In 6-well plates, cells were cultivated to 95% confluency. A sterile pipette tip was used to make a linear scratch wound. Images of the wound were taken at 0 hours after it had been cleaned twice with PBS to get rid of any unattached cells. Following cell culture in serum-free media, imaging was used to record wound closure at the 48-hour mark.
Transwell chambers (24-well format) covered with Matrigel were used to measure cell invasion. (Corning, 35623, Corning, NY, USA). The lower chamber was filled with media containing 10% FBS as a chemoattractant, while the upper chamber was seeded with cells. A cotton swab was used to remove non-invading cells from the upper membrane surface after a 48-hour incubation period at 37℃. Under an inverted microscope, cells that had colonized the lower surface were counted after being fixed with 4% formaldehyde and stained with 0.3% crystal violet.
Quantitative real-time polymerase chain reaction (qPCR)
RNA Easy Isolation Reagent (Vazyme, R70101) was used to isolate total RNA. The concentration and purity of RNA (A260/A280≥1.8) were assessed using a Thermo Fisher Scientific NanoDrop spectrophotometer (Waltham, MA, USA). The ABScript Neo RT Master Mix and gDNA Remover Kit (ABclonal, RK20433) was used to create cDNA from 1 µg of total RNA. SYBR Green qPCR Faster Mix (ABclonal, RK21219) was used for qPCR on the C1000 Touch Thermocycler CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA). Every reaction was carried out three times. The 2–ΔΔCt technique was used to calculate relative gene expression, and GAPDH was used as the endogenous control.
Primer sequences:
- KCNH1: F, AGTGGCCCCTCAAAACACG; R, CTATCTGAGCATTCCCCAACAC;
- CTNND2: F, GAGCCCCGGCTTAAACACC; R, CCTGTTCTTTGACTGAGGCGA;
- DNAH5: F, TCTGGAAGCATAGCGTCACTC; R, CCTCCACTTCGGTTTTGTTCA;
- ANXA8: F, CATGATCATGCTGCTGAGGGTC; R, GGAGCAGGGACGCGTGAT;
- GAPDH: F, ACAACTTTGGTATCGTGGAAGG; R: GCCATCACGCCACAGTTTC.
Genetic manipulation: knockout (KO) and overexpression (OE)
KCNH1 KO was achieved using the CRISPR/Cas9 system. A target-specific sgRNA was designed by Sangon Biotech (Shanghai, China) and cloned into the lentiCRISPRv2 plasmid (Addgene, Cambridge, MA, USA). The pLVX-puro–based plasmids served as the backbone for overexpressing KCNH1 were obtained from Sangon Biotech. Plasmids were packaged into lentiviral particles (ZORIN Biotech Ltd., Shanghai, China) in HEK293T cells. Forty-eight hours after transfection, the virus-containing supernatant was collected, filtered, and utilized to transduce target cells. Western blotting was used to confirm the efficiency of gene editing after target cells were transduced and chosen using 2 µg/mL puromycin (P8230, Solarbio).
Single guide RNA (sgRNA) sequence: AGCCAGAAACCACAAAGCAG.
To assess potential off-target sites of the designed sgRNA, nucleotide BLAST searches were performed using the NCBI BLAST online interface against the human GRCh38 genome database. Potential off-target effects were further validated by qPCR experiments.
RNA-seq and bioinformatic analysis
The TRIzol reagent (15596-026, Invitrogen) was used to extract total RNA. An Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) were used to confirm the quality and integrity of the RNA. Three biological replicates were subjected to RNA-sequencing (RNA-seq) for each experimental group by OE Biotech Co., Ltd. (Shanghai, China). The sequenced reads were compared to the reference genome to quantify the expression of genes that code for proteins. The computed gene expression levels across samples were then used to perform a differential expression analysis.
Dual-luciferase reporter assay
A human KCNH1 promoter reporter construct was generated by ligating truncated fragments of the KCNH1 promoter into the pGL3 vector (Sangon Biotech), which encodes firefly luciferase. Cells were co-transfected with this firefly luciferase construct along with a Renilla luciferase reporter plasmid for data normalization. At 24 hours post-transfection, cells were lysed by the Dual-Luciferase® Reporter Assay System (11402ES60, Yeasen, Shanghai, China) and luciferase activity was measured with a Synergy H1 multimode reader (Agilent Technologies). Relative promoter activity was determined as the ratio of firefly to Renilla luciferase activity.
Statistical analysis
Blinding was not implemented in this study, as data acquisition was largely automated or based on objective quantitative measurements. Three biological separate experiments’ worth of data are presented as mean ± standard deviation. The normality was assessed using the Shapiro-Wilk test. Homogeneity of variances was assessed using the Brown-Forsythe test.
For comparisons between two groups, a two-tailed unpaired t-test was used. For multi-group comparisons, one-way analysis of variance (ANOVA) followed by Tukey’s HSD post hoc test was applied. Two-way ANOVA followed by Tukey’s HSD post hoc test were performed for comparisons among groups of two factor experiments. The criteria for statistical significance were *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001. GraphPad Prism software (10.2.3) was used for all statistical analyses. As this study did not involve human experiments, animal experiments, case report or case series, an additional ethical statement was not required.
Results
Macropinocytosis and its inhibitors affect LUAD cell malignant phenotypes
To systematically investigate whether and how macropinocytosis influences key features of LUAD malignant phenotypes, we employed two representative LUAD cell lines: H358 (KRAS-G12C mutant) and H1975 (KRAS wild-type). This selection was based on the established role of the oncogene KRAS in enhancing macropinocytic activity (19), thereby providing a model with intrinsically different baseline macropinocytosis levels. Pharmacological inhibition was achieved using EIPA, a well-characterized and specific macropinocytosis inhibitor (16,26), with DMSO serving as the solvent control.
To first confirm the differential macropinocytic activity and the efficacy of EIPA, we performed a TMR-dextran uptake assay. Under control (DMSO) conditions, H358 cells exhibited significantly higher TMR-dextran fluorescence intensity compared to H1975 cells, indicating elevated baseline macropinocytosis in the mutant background. Treatment with EIPA (25 µM) markedly reduced TMR-dextran uptake in both cell lines, confirming successful pharmacological inhibition (Figure 1A,1B).
Initial characterization under control conditions revealed significant differences in malignant behaviors between the two cell lines, consistent with their distinct KRAS/macropinocytosis capacities. Compared to H1975 cells, H358 cells exhibited significantly higher proliferative capacity (Figure 1C), migratory ability (Figure 1D,1E), and invasive potential (Figure 1F,1G). Notably, such intrinsic disparity was not observed in the basal apoptosis rate, possibly attributable to factors such as time-dependent effects. (Figure 1H). These findings suggest that differences in baseline macropinocytic activity, driven by KRAS status, substantially contribute to the heterogeneity of LUAD cell malignant phenotypes.
Subsequently, we evaluated the consequences of inhibiting macropinocytosis. Compared to the control groups, continuous EIPA treatment for 5 days significantly reduced the proliferative capacity of both H358 and H1975 cells (Figure 1C), as determined by the CCK-8 assay. In contrast, EIPA did not significantly alter apoptosis within a 24-hour treatment period, indicating that EIPA may primarily lead to cell proliferation arrest, rather than directly killing tumor cells (Figure 1H). The suppression of macropinocytosis significantly reduced the migratory capacity of H358 and H1975 cells in wound-healing tests. (Figure 1D,1E). Similarly, Transwell invasion assays showed a substantial reduction in the number of invading cells following EIPA treatment (Figure 1F,1G).
Collectively, these functional analyses establish a compelling association between macropinocytic activity and core malignant phenotypes in LUAD. Macropinocytosis, associated with KRAS status, is a key determinant of differential LUAD cell proliferation, migration, and invasion. EIPA-mediated inhibition universally attenuates core pro-tumor phenotypes across different genetic backgrounds. This strongly suggests that macropinocytosis is not merely a passive metabolic adaptation but an active enhancer of malignant behaviors in LUAD cells.
RNA-seq identifies KCNH1 as a key downstream target of macropinocytosis
The next step is to clarify the molecular processes that underlie macropinocytosis’ pro-tumor function in LUAD. We performed transcriptomic analysis via RNA-seq. This analysis aimed to explore differentially expressed genes (DEGs) induced by the pharmacological inhibition of macropinocytosis with EIPA, i.e., the downstream effectors of macropinocytosis in the context of LUAD malignant phenotypes. H358 and H1975 cells, representing models with intrinsically different baseline macropinocytic activities, were treated with DMSO or EIPA (25 µM) for 24 hours prior to sequencing.
Hierarchical clustering analysis of the transcriptomic data revealed distinct global gene expression profiles between EIPA-treated samples and DMSO-treated control samples in both H358 (Figure 2A) and H1975 (Figure 2B) cell lines. This clear separation highlights the extensive transcriptional reprogramming induced by macropinocytosis inhibition. Volcano plot analysis further delineated specific DEGs, visually presenting genes significantly upregulated and downregulated upon EIPA treatment in each cell line (Figure 2C,2D).
To precisely identify core effector genes commonly regulated by macropinocytosis across different genetic backgrounds, we performed an intersection analysis of the downregulated DEGs from H358 and H1975 cells. Comparative analysis via Venn diagram identified KCNH1 as the most prominently downregulated candidate gene [log2fold change (FC) =−2.15 in H358 cells, log2FC =−5.78 in H1975 cells] (Figure 2E). Thus, this unbiased genomic approach nominates KCNH1 as a key downstream transcriptional target associated with macropinocytosis in LUAD.
Unidirectional regulatory axis from macropinocytosis to KCNH1
We next investigated the causal relationship between macropinocytosis and KCNH1. Consistent with our RNA-seq results, pharmacological inhibition of macropinocytosis with EIPA (25 µM, 24 hours) significantly downregulated KCNH1 at both mRNA and protein levels, as confirmed by qPCR and Western blot (Figure 3A-3C; the original blot for Figure 3B is shown in Figure S1A). To further explore whether macropinocytosis transcriptionally regulates KCNH1, we performed a dual-luciferase reporter assay using the KCNH1 promoter. EIPA treatment significantly reduced KCNH1 promoter activity in both H358 and H1975 cells, indicating that macropinocytosis regulates KCNH1 expression at the transcriptional level (Figure 3D).
Next, we employed genetic editing to test the inverse hypothesis—whether KCNH1 itself can regulate macropinocytic activity. Using CRISPR/Cas9-mediated gene KO, we successfully abolished KCNH1 expression in H358 cells, which exhibit high baseline KCNH1 expression. Conversely, we established a stable KCNH1 OE model in H1975 cells with low baseline KCNH1 expression (Figure 3E,3F; the original blot for Figure 3E is shown in Figure S1B). To exclude potential confounding effects from off-target editing, we examined the mRNA expression of three candidate off-target genes (ANAX8, DNAH5, CTNND2) and found no significant alterations following KCNH1 KO (Figure 3G). We then assessed the macropinocytic capacity of these genetically engineered cells using the TMR-dextran uptake assay. Surprisingly, neither KCNH1 KO in H358 cells nor KCNH1 OE in H1975 cells resulted in significant alterations in macropinosome formation compared to their respective wild-type (WT) or vector control cells (Figure 3H,3I).
These complementary pharmacological and genetic experiments collectively define a unidirectional regulatory axis. Macropinocytosis acts upstream, positively regulating KCNH1 expression at the transcriptional level. In contrast, KCNH1 does not function as a feedback regulator of the macropinocytosis process itself. Therefore, in LUAD cells, KCNH1 is positioned as a downstream transcriptional effector of macropinocytosis signaling.
Macropinocytosis enhances malignant behaviors in LUAD cells through KCNH1
Finally, to confirm that KCNH1 is a key functional mediator through which macropinocytosis enhances malignant behaviors in LUAD cells, we conducted a series of gain-of-function and loss-of-function experiments. We first explored whether forced KCNH1 expression could counteract the anti-tumor effects of macropinocytosis inhibition. In H1975 cells with relatively low baseline KCNH1 levels, stable KCNH1 OE significantly increased cell proliferation (Figure 4A), migration (Figure 4B,4C), and invasion (Figure 4D,4E) compared to vector control cells under baseline conditions. Importantly, KCNH1 OE largely rescued the impaired phenotypes caused by EIPA treatment (Figure 4A-4E), indicating that KCNH1 acts downstream of macropinocytosis to sustain malignant behaviors.
Conversely, genetic knockout of KCNH1 in H358 cells with high baseline KCNH1 expression produced the opposite effect. Compared to WT cells, KCNH1 KO led to significant reductions in proliferation (Figure 4F), migration (Figure 4G,4H), and invasion (Figure 4I,4J). This loss-of-function phenotype further strengthens the link between the macropinocytosis-KCNH1 unidirectional axis and the enhancement of malignant behaviors in LUAD cells.
Given that previous studies have demonstrated that KCNH1 promotes tumor malignant behaviors via the PI3K/AKT signaling pathway in other cancer types (27), we further examined whether this pathway mediates the malignant phenotypes induced by KCNH1 upregulation in LUAD cells. Western blot analysis revealed that KCNH1 KO in H358 cells significantly reduced the phosphorylation levels of AKT, whereas KCNH1 OE in H1975 cells increased their phosphorylation levels, without altering total protein expression (Figure 4K,4L; the original blot for Figure 4K is shown in Figure S1C). These findings indicate that KCNH1 can enhance malignant phenotypes in LUAD cells through activating the PI3K/AKT signaling pathway.
Clinical significance of KCNH1 expression in LUAD
We examined KCNH1 expression in a sizable cohort of LUAD samples from The Cancer Genome Atlas (TCGA) to validate the clinical significance of our mechanistic findings. The data showed that KCNH1 mRNA levels were significantly higher in tumor tissues (n=515) compared to matched normal lung tissues (n=59) (Figure 5A). Further analysis based on clinical pathological stages revealed that KCNH1 expression levels were significantly elevated in stage I and stage II LUAD tumor tissues compared to normal lung tissues (Figure 5B). Additionally, analysis of survival data from TCGA LUAD patients did not reveal a clear association between KCNH1 expression levels and overall survival (Figure 5C).
Collectively, these data provide coherent genetic and clinical evidence that KCNH1 acts as a key downstream effector, functionally linking macropinocytic activity to the enhancement of malignant behaviors in LUAD cells. Targeting KCNH1 may hold promise for suppressing the proliferation, migration, and invasion of LUAD cells.
Discussion
Key findings
This study provides the first systematic evidence that macropinocytosis functionally enhances malignant phenotypes in LUAD cells. We demonstrate that pharmacological inhibition of macropinocytosis attenuates core malignant phenotypes—proliferation, migration, and invasion—across LUAD cell lines with distinct genetic backgrounds. Crucially, through an unbiased transcriptomic approach, we identified the potassium channel gene KCNH1 as a key downstream transcriptional target of macropinocytic activity. We established a unidirectional regulatory axis wherein macropinocytosis positively regulates KCNH1 expression at both mRNA and protein levels, while KCNH1 does not feedback to modulate macropinocytosis itself. Functional rescue and loss-of-function experiments conclusively showed that KCNH1 is necessary and partially sufficient to mediate the pro-tumorigenic effects of macropinocytosis. The clinical relevance of this axis is supported by the significant upregulation of KCNH1 in LUAD tumor samples from the TCGA database.
Strengths and limitations
A major strength of this work is the combinatorial use of pharmacological inhibition and genetic manipulations in two well-characterized LUAD cell models, which robustly dissects causality within the macropinocytosis-KCNH1 axis. The integration of unbiased RNA-seq for mechanistic discovery with functional validations provides a comprehensive narrative.
Several limitations should be acknowledged. First, although RNA-seq identified KCNH1 as the top differentially expressed candidate based on fold change, other genes such as NXPH3, PTGDR2, and SSC4D were also significantly altered by EIPA treatment. NXPH3 is a secreted signaling molecule belonging to the neurexophilin family (28). PTGDR2 is involved in inflammatory and immune modulation in the tumor microenvironment (29). SSC4D is a scavenger receptor cysteine-rich family member potentially linked to endocytic processes (30). These genes may represent parallel downstream effectors of macropinocytosis, and their potential contributions to LUAD malignant phenotypes warrant further investigation. Beyond individual genes, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of the RNA-seq data revealed that the Hippo signaling pathway was significantly enriched among DEGs upon EIPA treatment, suggesting that macropinocytosis may regulate LUAD malignant phenotypes through additional parallel mechanisms distinct from KCNH1 upregulation. Second, while we demonstrate that macropinocytosis regulates KCNH1 expression at the transcriptional level via promoter activity, the complete molecular cascade linking macropinocytosis to KCNH1 transcription—including potential transcription factors or epigenetic modifiers—remains to be fully elucidated. Third, although TCGA database confirmed KCNH1 upregulation in LUAD tumors, particularly in stage I–II, no significant association with overall survival was observed. This may be attributed to the relatively small sample size of advanced-stage patients, functional compensation by other potassium channels, or the possibility that KCNH1 primarily drives early-stage tumorigenic phenotypes rather than late-stage progression or metastasis. Fourth, our study lacks independent clinical cohort validation to directly link the macropinocytosis-KCNH1 axis to disease progression or treatment outcomes in patients. Fifth, while all functional assays were performed with rigorous experimental controls, blinded assessment was not systematically implemented. However, this limitation is mitigated by the fact that all data acquisition was largely automated or based on objective quantitative measurements.
Comparison with similar research
Our findings align with and extend the established paradigm of macropinocytosis as a critical nutrient-scavenging and tumor-promoting pathway in cancers such as pancreatic ductal adenocarcinoma (PDAC) and glioblastoma (16,31,32). Mechanistically, the functional consequences of macropinocytosis inhibition—reduced proliferation, migration, and invasion—are consistent across these tumor types, suggesting a core, conserved pro-tumorigenic role regardless of genetic context. However, the downstream effector mechanisms diverge. In PDAC, macropinocytosis primarily supports tumor growth by fueling cellular metabolism through the internalization and lysosomal degradation of extracellular proteins (16). In contrast, our study demonstrates that in LUAD, macropinocytosis drives malignant phenotypes predominantly through transcriptional upregulation of the potassium channel KCNH1. Furthermore, while KCNH1 has been previously implicated in cell cycle progression, migration, and AKT phosphorylation in other cancer types such as HeLa cells (22,23,27,33), its regulation by macropinocytosis—or by any nutrient-scavenging pathway—has not been reported. Our finding that macropinocytosis transcriptionally controls KCNH1 expression via promoter activity reveals a previously unrecognized link between bulk endocytic nutrient uptake and ion channel gene regulation. Moreover, we validate that in LUAD cells, KCNH1 also promotes malignant phenotypes at least in part through AKT phosphorylation, indicating that this downstream signaling mechanism is conserved across different cellular contexts. Collectively, these findings position our work at a novel intersection of nutrient sensing, ion channel biology, and cancer cell malignant phenotypes, while also highlighting cancer type-specific diversification of macropinocytosis upstream signaling alongside conserved downstream executor mechanisms.
Explanations of findings
The observed downregulation of malignant behaviors upon macropinocytosis inhibition likely stems from a dual mechanism: a direct metabolic deprivation (15,16), and an indirect signaling disruption via downregulation of effectors like KCNH1. As an oncogenic ion channel, KCNH1 may promote proliferation and migration by modulating membrane potential, calcium signaling, or interacting with growth factor pathways (27,34,35). Its upregulation by macropinocytosis could thus represent a feed-forward mechanism where nutrient acquisition pathways concurrently activate downstream proliferative and invasive programs. The inability of KCNH1 to modulate macropinocytosis reinforces its position as a terminal effector rather than a regulator of the uptake process itself.
Implications and actions needed
The macropinocytosis-KCNH1 axis represents a promising therapeutic target for LUAD. It is tempting to speculate that targeting downstream effectors such as KCNH1 might offer greater specificity compared with inhibiting the core macropinocytic machinery, potentially reducing off-target effects. However, this hypothesis remains to be tested, as the present study was conducted exclusively in LUAD cell lines and lacks in vivo models to assess its potential toxicity and therapeutic efficacy. Immediate future work should focus on the following aspects: first, delineating the exact transcriptional regulators that connect macropinocytosis to KCNH1 promoter activity; second, evaluating the efficacy and specificity of KCNH1 inhibitors, alone or in combination with macropinocytosis inhibitors, in preclinical models including normal lung epithelial cells, xenograft models, and patient-derived organoid models; and third, exploring the prognostic value of macropinocytic activity and KCNH1 expression in LUAD patient cohorts, specifically by examining KCNH1 expression changes in the subset of patients who experience disease progression following targeted therapy or immunotherapy.
Conclusions
In conclusion, our results demonstrate that macropinocytosis actively enhances malignant phenotypes in LUAD cells. This effect is mediated, at least in part, through the transcriptional upregulation of the potassium channel gene KCNH1. Pharmacological or genetic disruption of this axis significantly impairs cancer cell proliferation, migration, and invasion. These findings identify the macropinocytosis-KCNH1 signaling pathway as a novel contributor to LUAD malignancy and a potential target for therapeutic intervention.
Acknowledgments
The authors sincerely thank all colleagues in the research group for their continuous support, insightful discussions, and encouragement during the course of this work.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jlpm.amegroups.com/article/view/10.21037/jlpm-2026-0020/rc
Data Sharing Statement: Available at https://jlpm.amegroups.com/article/view/10.21037/jlpm-2026-0020/dss
Peer Review File: Available at https://jlpm.amegroups.com/article/view/10.21037/jlpm-2026-0020/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jlpm.amegroups.com/article/view/10.21037/jlpm-2026-0020/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. No ethical approval or informed consent is required due to no human beings involved in this study.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021;71:209-49. [Crossref] [PubMed]
- Siegel RL, Miller KD, Fuchs HE, et al. Cancer statistics, 2022. CA Cancer J Clin 2022;72:7-33. [Crossref] [PubMed]
- Thai AA, Solomon BJ, Sequist LV, et al. Lung cancer. Lancet 2021;398:535-54. [Crossref] [PubMed]
- Duma N, Santana-Davila R, Molina JR. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis, and Treatment. Mayo Clin Proc 2019;94:1623-40. [Crossref] [PubMed]
- Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer. Nature 2018;553:446-54. [Crossref] [PubMed]
- Rotow J, Bivona TG. Understanding and targeting resistance mechanisms in NSCLC. Nat Rev Cancer 2017;17:637-58. [Crossref] [PubMed]
- Reck M, Remon J, Hellmann MD. First-Line Immunotherapy for Non-Small-Cell Lung Cancer. J Clin Oncol 2022;40:586-97. [Crossref] [PubMed]
- Arbour KC, Riely GJ. Systemic Therapy for Locally Advanced and Metastatic Non-Small Cell Lung Cancer: A Review. JAMA 2019;322:764-74. [Crossref] [PubMed]
- Doroshow DB, Sanmamed MF, Hastings K, et al. Immunotherapy in Non-Small Cell Lung Cancer: Facts and Hopes. Clin Cancer Res 2019;25:4592-602. [Crossref] [PubMed]
- DeBerardinis RJ, Chandel NS. We need to talk about the Warburg effect. Nat Metab 2020;2:127-9. [Crossref] [PubMed]
- Pavlova NN, Thompson CB. The Emerging Hallmarks of Cancer Metabolism. Cell Metab 2016;23:27-47. [Crossref] [PubMed]
- Faubert B, Solmonson A, DeBerardinis RJ. Metabolic reprogramming and cancer progression. Science 2020;368:eaaw5473. [Crossref] [PubMed]
- Finicle BT, Jayashankar V, Edinger AL. Nutrient scavenging in cancer. Nat Rev Cancer 2018;18:619-33. [Crossref] [PubMed]
- Zhang Y, Commisso C. Macropinocytosis in Cancer: A Complex Signaling Network. Trends Cancer 2019;5:332-4. [Crossref] [PubMed]
- Jayashankar V, Edinger AL. Macropinocytosis confers resistance to therapies targeting cancer anabolism. Nat Commun 2020;11:1121. [Crossref] [PubMed]
- Commisso C, Davidson SM, Soydaner-Azeloglu RG, et al. Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells. Nature 2013;497:633-7. [Crossref] [PubMed]
- Kamphorst JJ, Nofal M, Commisso C, et al. Human pancreatic cancer tumors are nutrient poor and tumor cells actively scavenge extracellular protein. Cancer Res 2015;75:544-53. [Crossref] [PubMed]
- Nofal M, Zhang K, Han S, et al. mTOR Inhibition Restores Amino Acid Balance in Cells Dependent on Catabolism of Extracellular Protein. Mol Cell 2017;67:936-946.e5. [Crossref] [PubMed]
- Tang D, Wang J, Kroemer G, et al. Targeting macropinocytosis for cancer therapy. Nat Rev Cancer 2026;26:167-84. [Crossref] [PubMed]
- Song S, Zhang Y, Ding T, et al. The Dual Role of Macropinocytosis in Cancers: Promoting Growth and Inducing Methuosis to Participate in Anticancer Therapies as Targets. Front Oncol 2020;10:570108. [Crossref] [PubMed]
- Salloum G, Bresnick AR, Backer JM. Macropinocytosis: mechanisms and regulation. Biochem J 2023;480:335-62. [Crossref] [PubMed]
- Pardo LA, Stühmer W. The roles of K(+) channels in cancer. Nat Rev Cancer 2014;14:39-48. [Crossref] [PubMed]
- Hemmerlein B, Weseloh RM, Mello de Queiroz F, et al. Overexpression of Eag1 potassium channels in clinical tumours. Mol Cancer 2006;5:41. [Crossref] [PubMed]
- Restrepo-Angulo I, Sánchez-Torres C, Camacho J. Human EAG1 potassium channels in the epithelial-to-mesenchymal transition in lung cancer cells. Anticancer Res 2011;31:1265-70.
- Ke Z, Tang Z, Shen D, et al. Co-Highly Expressed SLC17A9 and KCNH1 as Potential Prognostic Biomarkers and Therapeutic Targets in Clear Cell Renal Cell Carcinoma. Front Biosci (Landmark Ed) 2025;30:38061. [Crossref] [PubMed]
- Koivusalo M, Welch C, Hayashi H, et al. Amiloride inhibits macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. J Cell Biol 2010;188:547-63. [Crossref] [PubMed]
- Wang X, Chen Y, Liu H, et al. A novel anti-cancer mechanism of Nutlin-3 through downregulation of Eag1 channel and PI3K/AKT pathway. Biochem Biophys Res Commun 2019;517:445-51. [Crossref] [PubMed]
- Missler M, Südhof TC. Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci 1998;18:3630-8. [Crossref] [PubMed]
- Tian H, Ge K, Wang L, et al. Advances in PGD2/PTGDR2 signaling pathway in tumors: A review. Biomol Biomed 2024;24:1055-67. [Crossref] [PubMed]
- Cardoso MS, Santos RF, Almeida S, et al. Physical Interactions With Bacteria and Protozoan Parasites Establish the Scavenger Receptor SSC4D as a Broad-Spectrum Pattern Recognition Receptor. Front Immunol 2021;12:760770. [Crossref] [PubMed]
- Wang B, Yao X, Dong Q, et al. Quantitation of macropinocytosis in glioblastoma based on high-content analysis. J Neurosci Methods 2023;397:109947. [Crossref] [PubMed]
- Yen HR, Liao WC, Chen CH, et al. Targeting chondroitin sulfate suppresses macropinocytosis of breast cancer cells by modulating syndecan-1 expression. Mol Oncol 2024;18:2569-85. [Crossref] [PubMed]
- Acuña-Macías I, Vera E, Vázquez-Sánchez AY, et al. Differential regulation of human Eag1 channel expression by serum and epidermal growth factor in lung and breast cancer cells. Onco Targets Ther 2015;8:2959-65. [Crossref] [PubMed]
- Luis E, Anaya-Hernández A, León-Sánchez P, et al. The Kv10.1 Channel: A Promising Target in Cancer. Int J Mol Sci 2022;23:8458. [Crossref] [PubMed]
- Urrego D, Tomczak AP, Zahed F, et al. Potassium channels in cell cycle and cell proliferation. Philos Trans R Soc Lond B Biol Sci 2014;369:20130094. [Crossref] [PubMed]
Cite this article as: Wang M, Guo S, Wang J, Zhang X, Tian X. Macropinocytosis promotes lung adenocarcinoma cell malignancy by upregulating KCNH1 expression. J Lab Precis Med 2026;11:25.

